RolePlayGateway™

Looking for some general advice on playing characters smarter than myself and especially playing characters with expertise that I don't have (particularly in areas I don't have much personal interest). For example, I have a few characters that are biologists but my knowledge of biology barely exceeds what I learned in high school.

I know I don't need to constantly reassert that they're "smart" but I feel like when I play or write these characters, I'm not doing it quite right. I myself am an artist, so I don't have a very good frame of reference for more analytical types of characters.

Also, how do you play a character who's a scientist without potentially wasting hours learning about their specialty? I thought "Well, maybe I should learn as much as I can about biology in this case," but how much of that information would I actually need/use? Since I don't have time to become an expert on the profession of all of my characters, it seemed inconvenient.

Thanks in advance, everyone~ :3

Quick edit: I didn't mean to imply that I didn't want to research at all. In fact, I actually enjoy the research I do for most of my projects/characters. But I was wondering how to effectively RP/write such a character without seeming like I was trying to come off as an expert on a subject I obviously have no real experience in.

I just wanted to ask how other people efficiently research fields they write characters in without becoming absolute experts in them. If the answer is "They don't," that's fine too--I'll just have to put off writing these characters until I have the time to do that. Right now, I really don't.

Thanks for all the replies so far, I really appreciate it. Although I had also hoped that I could post my question here without having to worry about snap judgments about me. =/

Want to write about some subject?

Get off your lazy butt and research the god-damned subject.

lol just make it sound good....

As Village Alchemist so eloquently put it, the best solution would be to take an interest in whatever your character specializes in. I, personally, find it fun to research a topic that my character has skills in simply because it draws me that much deeper into the world I'm creating. Probably a side effect of being a part time writer...


Anyway; The next best solution would be to find something that there are many reference articles on, I suppose. Something that you could easily brush up on in a short amount of time. I wouldn't suggest going for Bio-engineering in this scenario. In the end, you should probably just do characters that you are comfortable with.

Its always possible to just research little bits you need as you write, for example, if you needed to know what atery was in a forearm or something, search it and find out, no need for you to remember it after you've typed it into the post.

The problem with ImmortalEcstacy's approach is that writing a character with a base of knowledge behind you always flows a whole lot better than inserting random bits of jargon into every third sentence, or having to shoehorn in a badly thought out explanation because you've only just gone and looked it up.

Like VillageAlchemist said, the best, and in my opinion only way to play characters who are smarter than you, or specialists in a certain subject, is to become versed in that subject yourself.

It's the same principle as trying to sound like you know about something in a general conversation, when really you dont. There will come a point where general knowledge and the little you've picked up fails.

So yeah, if you want to play a character who specialises in something, and play them well, then you're gonna have to go do some research.

Wikipedia solves all problems. Whenever I do a character who specializes in psychology, I read an article on it on Wikipedia. Or, if a character has a mental or physical ailment, I search that too. It's how I more realistically flesh out problems or advantages.

Seraphic, Ylanne's and Original's responses are probably closest to the truth: when working on something that you're not confident about, you need to do research. However, if the topic of your character's expertise is not directly relevant to the story at hand, your audience will be content to simply believe that the character is an expert, without any proof. On the other hand, if your character is a biologist working on a solution for world hunger however, your expertise does not need to be based in reality - much as everyone makes things up about how magic works, you can make up some things about biology - when reading fiction we have all learned to suspend our disbelief. Your biggest challenge comes when you are playing a realistic roleplay with your character's expertise coinciding with the plot - Wikipedia is your best friend because it gives short bursts of knowledge without requiring you to parse through dense articles and textbooks.

Another option is to focus of the interpersonal relationships in your roleplay without delving into all of the expert details - if you have ever seen the show Scrubs, you will probably take for granted that all of the characters are good doctors, despite the fact that they rarely discuss the specifics of the illnesses they are treating or the surgeries they are performing. Caveat: the screenwriters probably did a lot of research to make sure the little bits the characters do say are all correct.

I don't think anyone's saying not to do research, but at the same time, I honestly don't expect someone playing a character with expertise in a certain field to know said field incredibly deeply. Yes, some research should certainly be done, but unless your character's biology work is actually going to come up often, you don't need to be an expert. Is it better if you are? Yes, absolutely. But here's an example. My mother is a biologist. She's a microbiologist, to be specific. From talking to her, you generally would not know it. She's not sitting there talking about microbiology constantly. The most she generally mentions is maybe how a machine isn't working at the lab or how she got a new shipment of milk in. She also talks about things like how her boss is a computer geek, how one of the women she works with is very nice but smells horribly, and how she once punched a co-worker/friend and made him cry. Biology jobs are also... well, jobs, and the people who work them are actually people, and getting too very preoccupied with "[x] is a [insert career]!" can lead you to lose sight of the fact that [x] is also a person.

Additionally, biology (working with that, but this applies to a lot of things) is a huge field. You can be a microbiologist, a bio-engineer, a zoologist, etc. Figure out what your character does and focus on that in any research you do. Again, my mom's a microbiologist. She knows a lot about animals because she loves them, but she wasn't able to study zoology; thus, she doesn't know zoology on that level. Even with microbiology, at this point? I'd say she's mostly familiar with the knowledge she needs for her job. Not every biologist is out there doing cutting edge experiments, either. She tests water and milk for harmful bacteria.

The point I'm trying to make here is that you can stick to what you know and what you research without investing your entire life into studying biology. I'm going to be honest here, you're probably not going to attain the same level of knowledge as a real biologist without, you know, studying biology and working as a biologist. That people suggest you should be able to is a little unfair. In the end, your character probably isn't going to spend a lot of time gabbing about the intricacies of their career. Some people might do that, but a lot don't.

If the RP is going to have focus on your character's job, it becomes a lot more important, of course. Short of that, though? As background information, the "get a general background and then study what you need" approach is generally fine. In most cases, you really shouldn't be trying to "[insert] random bits of jargon into every third sentence". If you know you don't know how to talk about it... don't. When the subject of a job comes up, focus on how tired your character was from a hard day of work, how much his or her coworker annoys him/her, how that new secretary is awfully cute, etc. If the need to discuss biology comes up, on the other hand, do make sure you know what you're talking about before you start talking.

Setting and tone factors in, too. Washu from the Tenchi Muyo franchise is a scientific genius, but if you know anything about her or the series, you know it's all played for humor. Nobody's going, "BUT THAT DOESN'T FOLLOW THE REAL LIFE RULES OF SCIENCE!" in that case.

Thanks for all the replies. Just to clear things up (as I just edited my post to say), I am not saying "I want to write smart characters, but I don't wanna do ANY research." I'm sorry if it came off that way, but that's not it at all. I want to write smart characters, but I don't want to focus on what they do, I just want it to come across in the way they communicate/act. It comes off as really immature to me when people throw stuff in that they don't even understand at times to make their characters LOOK smart. I wanted to avoid that.

I just don't want to do tons of research that won't actually help me with my goal. Especially because I don't have the TIME to do it right now. And like I noted in my edit to my first post, it's okay if the answer is "No, you have to research a lot anyway, sorry." I don't mind researching. I just wondered what other people do. I don't know a lot of writers or RPers, so I've got no one to ask.

I generally don't focus on the particulars of what these characters do in any way. But the fact is, they're (potentially) not going to act just like everyone else, partially due to what their occupations are.

Anyway, thanks for all of the replies, they've all been helpful in looking into the way other people do this kind of thing, which is what I wanted, really.

Google it or Wikipedia it. Its how the world pretends it knows stuff it shouldn't. Otherwise, lying and making stuff up will have to do.

>Marionette

Thank you SO MUCH for understanding what I meant.

I don't believe I'll ever be as knowledgeable about the field of biology--or the field that any of my characters are in--as they would be in real life. And that's exactly why I want to know just how much I need to know to play them without it coming off as me just trying to make them look like it by throwing in random jargon--a practice which annoys me to no end. I just want to be prepared for RPs or situations in RP where their work would come up--and I also wanted advice on effectively writing them in the story they belong in.

For one of them his job is basically his entire life (he's rather obsessive and doesn't have anything else), and for the other it comes up because he's fascinated by another of my characters (who isn't human). It's pretty obvious that for the first his job would come up often, and for the second it would come up more often if the other character was involved or mentioned.

And thank you for a very informative post as well.

It's easy to play experts in a field that you don't give two shakes of a lamb's tail about. Take assassins, for example, or in a modern-day analogy, snipers or police sharpshooters. Their knowledge of how, when, and where to shoot to kill requires years of study and discipline of such things as anatomy (where to shoot to do the most damage), behavioral psychology (how a subject is typically going to react to stimulus X), and physics (wind compensation and vector addition), not to mention being insanely comfortable with their weapon of choice (this could apply to most fighting characters, actually). In the case of the assassin, their expertise also can extend to chemistry and toxicology, as well as how to handle poison safely.

The most important thing to remember about this type of character is not to sweat the details. You can say that your character is working in the lab trying to develop a new poison/drug without actually going into detail about things like ambient conditions, the raw materials used, and so forth.

On the other hand, if you DO know a few important details related to the profession your character finds himself a member of, make sure to mention things like that when he's in a tough situation (a religious person might swear a minor oath to his god, for example). This most often comes to the forefront during a fight. Called shots to specific areas of the body is a terrific strategy, as careful selection of your target area basically dictates how many worlds of hurt you want to put your foe in. We all know the effects of a shot to the groin or abdomen, but consider additional options such as the throat or knee. The former can leave your foe unable to perform incantations or even maintain a fighting stance due to fits of coughing, whereas the latter is a great way to go for a knockdown if you're swinging from the side or rear.

In short; use what you know, and feel free to brush over what you don't.

Seraphic- Ahh, I see. Those cases would be trickier, but still not impossible. qbsuperstar03 made some good points there. I think most people will accept that a character is a biologist, even an expert biologist, simply because that's what's been said. Unless you start doing things that conflict with that statement, people will probably not raise any brows. If it's stated that a biologist character was spending long hours in a lab, I'd accept that without needing to know exactly what they were doing. If they'd accomplished something or other, I'd accept that, and depending upon what it was, I wouldn't need a detailed explanation. Biologists work in labs, and some biologists make breakthroughs. We accept that, say, some scientists in Japan made a new android without knowing from top to bottom how that android works. This is, of course, in the real world and applies to what we can experience ourselves, but this generally carries over into RP. I'm not looking for a rundown on exactly how a robot character functions. For the RP, it's understood that it does function, and that's what's important.

It'd still be safe to see if you could get your hands on some info about the procedure for the kind of work the obsessive character's doing, but even without it, you probably could find a way to convincingly gloss over it.

For the character who's interested in the nonhuman character, think about exactly why he's interested in that character. Is it because the nonhuman's internal systems boggle him? The way the limbs work? Does its mechanisms go against some accepted scientific law? Or is it simply because it's nonhuman (which I figure would include everything you possibly could think of about it that isn't exactly equivalent to a human's)? I don't know for sure what kind of character it is, but if it's an anthropomorphic type character, study the systems of the animal(s) it's based on and try to reconcile those characteristics with a human, and then you might be able to work out its biology to some extent. If it's an animal (even one you've made up), look at the biology of the real animals it is or most resembles. If it's something like a vampire or an alien, well, that's a little bit harder since those things do not exist in our world. Keep in mind you wouldn't necessarily have to say for sure what makes such things run, but you could have your character observing (watching, taking notes, etc.), reflecting, and making hypotheses. Hypotheses don't have to be accurate to anything because they're just educated guesses which could be nothing like what's really going on. It should just have some logic behind it. You could also try to hypothesize yourself on the character's systems and, again looking at real biological and scientific phenomena, come up with something that sounds decently plausible. It's RP. If there are nonhuman characters to begin with, you probably already have some amount of suspension of disbelief working for you.

I don't know why this seems to be difficult, and I'm sorry if you think you need to keep reasserting that you're not intending to do no research. I understand your plight, honestly. If you are eager to play the character in the meanwhile of your research, you should ask somebody or become friends with somebody who -does- have that expertise. If you can't find anybody, then you're going to have to do it instance by instance and be resourceful. Depending on the specification of which type of biology your character is interested, an example of resourcefulness would be, say, to look things up when you need them. Play the character normal most of the time, but demonstrate his intellect once in a while by doing on the spot research. I don't really know how to explain this clearly to you, but I do it all the time.

For instance, I used to know virtually nothing about herbs. But my character was a novice herbalist and had to know all basic herbs and their functions. I didn't sit and research every one of them, because, let's face it, however much people here may tell you that you should take an interest in what your character takes an interest in--that's not the case.

If you are playing a biology genius, and you aren't already a biology genius, you probably won't know anything to the extent you want to portray your character as knowing ever. So while you can do BASIC research, your character isn't going to demonstrate his genius by reiterating things that are basic. . . and things that are advanced you'll never really know. That's what on-the-spot research is for. If your character comes across some strange plant, whether or not it's made up, start doing an instantaneous search on poisonous plants and either piece one together in the realm you're in, or take a pre-existing one and use the information you just read about it.

I've gotten by for the last six years doing that, since I went 'outside of the box' with characters, and it hasn't really failed me yet.

Three Basic Rules that most writers live by in unfamiliar territory such as this can come in handy.

1. If you don't know much about it, chances are your audience wont either. This Rule can be subverted if you've been living under a rock, but thats probably not the case.

2. The best thing to do is get a basic understanding of the subject. As someone already stated, Wikipedia is great for this, depending on the subject. However, I wouldn't be to reliable on the site. ANYONE can edit it.

3. Finally, once you have the basic idea, just try to keep what happens pertaining to the subject sounding good. If it sounds good, the reader will more easily be able to "suspend their disbelief" and take what your character says for granted.

I beleive this is something along the lines of Crichton's (Jurassic Park, The Sphere) way of approaching scientific subjects, such as cloning in Jurassic Park. I don't think he had to be a professor of genetics to write the sciency bits. If in doubt about the beleivability of the story, throw in some real world trivia and facts where it fits, like how Crichton did when putting some DNA code within his book. ATCGAGCTAGCTGGATCGATCTGATCGATAGCTAGCT is alwasys a killer way to make the reader believe the story line if genetics are involved.

I agree with keeping it basic/simplistic and not using more than you need to get the point across. However, regarding Wikipedia, a common misconception is that it's a poor source. Although it can be edited by anyone, it is frequently checked and flagged for errors, inadequacy, poor citation, et cetera. If you are concerned about that, you can make good use of cross-referencing, or checking their sources cited at the bottom directly to ensure the information is legitimate. I disagree with the comment that 'if you aren't very knowledgeable, your audience probably won't either' . . . . The reason I disagree with this is, although it's true most probably will not, some might. . . and probably will. . . . and representing a character poorly, even if only a minority notice, can tarnish your writing reputation. Be careful with it, do your research, never guess, but stay to the bare minimum needed unless you can afford to become more in depth.